3.6 C
New York
Thursday, March 30, 2023

Ependymal polarity defects coupled with disorganized ciliary beating drive irregular cerebrospinal fluid move and backbone curvature in zebrafish


Introduction

Idiopathic scoliosis (IS), characterised by the irregular rotation and curvature of the backbone, is the commonest spinal deformity, affecting greater than 3% of kids and adolescents worldwide [1]. Though greater than 80% of scoliosis circumstances are deemed idiopathic, it’s believed that genetic components make important contributions to the development of the illness, based mostly on the excessive incidence of scoliosis in households and twins. Presently, the pathogenesis of IS stays largely unknown as a result of inadequate data of its etiology and subsequent illness development.

Just lately, the zebrafish has emerged as a robust mannequin for human scoliosis based mostly on comparable spinal column structure and vertebral constructions in zebrafish and people [24]. Furthermore, teleost fish exhibit a pure susceptibility to develop spinal curvatures over time, making zebrafish a dependable mannequin for human IS [2,4,5]. Certainly, latest work on a number of zebrafish scoliosis mutants has supplied important perception into molecular mechanisms regulating scoliosis, together with linking scoliosis to cerebrospinal fluid (CSF) move defects [6]. CSF is a transparent fluid that bathes the mind and spinal wire, is essential for sustaining homeostasis of the central nervous system (CNS), and is produced by specialised ependymal cells within the choroid plexus (CP) of the ventricles of the mind. CSF move is propelled by the beating of motile cilia, specialised, tiny organelles protruding from the floor of ependymal cells lining the mind ventricles and spinal canal. Zebrafish mutants exhibiting ciliary motility defects typically develop hydrocephalus and progressive late-onset scoliosis [6].

Along with scoliosis, zebrafish ciliary mutants consistently develop physique curvature at larval stage [7]. Research from our lab and different teams have recognized Urotensin as the foremost signaling pathway that features downstream of motile cilia to control physique axis improvement. Mechanistically, cilia-driven CSF move transmits adrenergic indicators to CSF-contacting neurons (CSF-cNs), selling the synthesis and secretion of urotensin neuropeptides, Urp1 and Urp2. These neuropeptides additional activate their receptor, Uts2r3 (beforehand named Uts2ra), a Urotensin-2 receptor particularly expressed in dorsal slow-twitch muscle fibers. Thus, indicators from CSF lastly direct dorsal muscle fiber contraction and management correct physique axis straightening throughout early improvement [811].

CSF-cNs are a specialised kind of neuron that may sense CSF environmental modifications, together with pH and osmolarity [12,13]. CSF-cNs additionally reply to the mechanical indicators associated to CSF move or tail bending, thus controling the locomotion of zebrafish larvae [1417]. CSF-cNs comprise extremely polarized apical protrusions, which assist modulate the mechanical sensory features of those neurons throughout spinal curvature [18]. The lumen of the central canal comprises an extended extracellular thread, the Reissner fiber (RF), which extends from the mind ventricle to the tip of the spinal canal. The RF is dynamically fashioned by the aggregation of SCO-spondin glycoprotein secreted from each the subcommissural organ and the ground plate in zebrafish [19]. CSF move is crucial for RF meeting and zebrafish mutants with ciliary defects are consistently related to RF loss [20]. Just lately, in depth research have demonstrated essential roles for the RF in mediating CSF signaling and controlling physique axis improvement [11,1922]. The RF is situated in shut neighborhood to the apical protrusions of the CSF-cNs, which assist transduce the mechanical indicators from spinal curvature or CSF move [21]. Zebrafish scospondin mutants fail to develop the RF and show extreme physique curvature defects [19,20,22].

Adrenergic indicators are essential for the activation of Urotensin neuropeptides within the CSF-cNs. The RF could present a scaffold or microenvironment to advertise the transduction of CSF adrenergic indicators to the CSF-cNs [11,23]. Apparently, the hypomorphic scospondin zebrafish mutants can survive to maturity and show scoliosis, suggesting a essential position for the RF throughout later physique axis improvement [10,19,22]. Equally, zebrafish uts2r3 mutants additionally show extreme scoliosis throughout late improvement [8]. These works recommend that defects within the Urotensin signaling pathway contribute to scoliosis formation. The Urotensin signaling pathway seems to be conserved in different vertebrates [24], and mutations in UTS2R, the human homolog of zebrafish uts2r3, can also be related to human scoliosis [25].

CSF is produced by the CP, a extremely specialised epithelium situated within the ventricles of the mind which are in shut contact with ependymal cells [26]. A key function of mind ventricle ependymal cells is the presence of a number of motile cilia of their apical floor, which have to beat in the identical route to correctly propel CSF move [27]. Planar cell polarity (PCP) indicators are important to outline the distribution of those cilia and make sure the correct route of ciliary beating [2830]. Of observe, ependymal cells show two forms of planar polarity—rotational PCP (rPCP) and translational PCP (tPCP)—based mostly on the orientation and positioning of basal physique clusters situated inside cells and tissues [31,32]. Motile cilia are important for regulating rPCP, whereas tPCP is established by main cilia of radial glial cells throughout differentiation [28,31]. Defects in ependymal cells, together with polarity defects, are sometimes related to hydrocephalus attributable to irregular CSF circulation [29,33].

Congenital hydrocephalus is a standard phenotype that happens in a number of human issues together with PCD [34]. Intriguingly, PCD sufferers additionally exhibit a excessive prevalence of scoliosis [35], though it stays unclear how hydrocephalus could consequence within the improvement of scoliosis. Equally, hydrocephalus and scoliosis happen in lots of zebrafish ciliary mutants. Apparently, spinal curvature didn’t develop in these ciliary mutants till roughly 3 weeks postfertilization, the same stage to the start of scoliosis in adolescent idiopathic scoliosis (AIS) sufferers. The molecular mechanisms of scoliosis improvement at these phases stays to be elucidated. Right here, now we have characterised a late-onset zebrafish scoliosis mutant exhibiting lack of operate of Ccdc57. Zebrafish ccdc57 mutants develop extreme hydrocephalus as a result of defects within the coordinated beating of a number of cilia. We offer knowledge displaying that Ccdc57 regulates ependymal PCP, whose defects are possible the foremost reason behind scoliosis formation in ccdc57 mutants. Furthermore, we describe the connection between backbone curvature and irregular Urotensin expression attributable to irregular CSF circulation, thereby offering vital mechanistic clues for the formation of scoliosis.

Outcomes

Mutation of ccdc57 leads to scoliosis in zebrafish

In an ENU-based display screen for zebrafish mutants with mineralized craniofacial and skeletal tissue defects, we recognized tft168N mutants that displayed extreme spinal curvatures in adults (Fig 1A). Each Micro-CT and Alizarin crimson staining confirmed that tft168N mutants displayed irregular three-dimensional curvatures and deformities of the spinal vertebrae when considered from each dorsal and lateral positions (Figs 1B and S1A). Apparently, the severity of the spinal curvatures was comparable in female and male zebrafish mutants, in that the cobb angles measured from dorsal-ventral and medio-lateral curvature confirmed comparable distribution patterns (S1B–S1E Fig). To establish the gene accountable for this phenotype, we carried out Subsequent Era sequencing and recognized a mutant locus on the genomic area encoding the ccdc57 gene. The ccdc57 gene comprises 19 exons encoding 979 amino acids, and the tft168N allele launched a cease codon within the eleventh exon of ccdc57 ensuing within the truncation of the ultimate 407 C-terminal amino acids (Fig 1C). To additional validate this gene mutation, we generated ccdc57 mutants through CRISPR/Cas9 strategies and recovered two mutant alleles, one with a 2-bp insertion (+2) and one other with a 7-bp deletion (Δ7) within the first exon (Fig 1C). Each of those two ccdc57 mutant alleles displayed scoliosis (Fig 1D). Furthermore, complementation testing between the Δ7 and tft168N alleles confirmed that these two alleles failed to enrich one another, confirming that mutations in ccdc57 have been causative for scoliosis in these mutants (Fig 1D). Of observe, when dissected from fastened vertebrae, ccdc57 mutant spinal cords additionally displayed curvature defects that intently mimicked these of the spinal curvatures (Fig 1E).

thumbnail

Fig 1. Mutation of ccdc57 results in scoliosis.

(A) Consultant photos of female and male wild kind and tft168N mutants. (B) Micro-CT photos displaying lateral and dorsal views of 3-months-old wild kind and tft168N mutants. (C) Genomic construction and sequences of untamed kind, tft168N mutant and two ccdc57 mutant alleles generated with CRISPR/Cas9. The underlined sequence in wt signifies PAM sequence of sgRNA goal. (D) Consultant photos of female and male wild kind and ccdc57 mutants with totally different genetic background as indicated. (E) The dissected mind and spinal wire in wild kind and ccdc57 mutant. Scale bars: 1 cm in panels A, B, D, E.


https://doi.org/10.1371/journal.pbio.3002008.g001

To outline the development of scoliosis in ccdc57 zebrafish mutants, we carried out developmental analyses of the mutant phenotype. Zygotic ccdc57Δ7 mutants displayed physique curvature at 3 days postfertilization (dpf) (S2A Fig). Apparently, physique curvature was not obvious in 3 dpf ccdc57tft168N mutants (S2A Fig). Such disparity could also be as a result of presence of truncated types of Ccdc57 proteins within the ccdc57tft168N mutants, because the tft168Nallele encodes the N-terminal 572 amino acids of Ccdc57 (Fig 1C). Furthermore, maternal Ccdc57 protein could contribute to early embryonic improvement. Certainly, maternal zygotic (MZ) ccdc57tft168N mutants displayed physique curvature defects at each 3 and 5 dpf, much like these of MZ ccdc57Δ7 mutants (S2A Fig). Within the following research, we centered on the ccdc57Δ7 mutant allele to guage the operate of Ccdc57 in spinal improvement and scoliosis.

In zebrafish, ciliogenesis defects are a serious reason behind physique curvature improvement [7]. We subsequently examined cilia improvement in ccdc57 mutants. Surprisingly, all the cilia examined have been grossly regular within the ccdc57 mutants as visualized utilizing anti-glycylated tubulin antibody (S2B–S2F Fig). Though irregular notochord differentiation can contribute to the event of congenital scoliosis, we didn’t detect any notochord defects in ccdc57 mutants at early phases, suggesting an impartial mechanism of scoliosis development within the absence of Ccdc57 (S2G Fig). In truth, scoliosis was first detected at roughly 17 dpf in each ccdc57tft168N and ccdc57Δ7 mutants, with preliminary bending of the mutant backbone occurring within the center portion of the trunk (S2H and S2I Fig).

Hydrocephalus in ccdc57 mutants

Just lately, irregular CSF move has been linked to the event of scoliosis [6,8]. Subsequently, to raised assess the etiology of scoliosis development in ccdc57 mutants, we dissected complete brains from ccdc57 mutants and wild kind sibling controls. The ccdc57 mutant mind was bigger and appeared clear as a result of an expanded ependymal epithelium crammed with CSF (Fig 2A and 2B). Histological evaluation of cross-sectioned brains revealed the presence of dilated ventricles within the optic tectum and rhombencephalon of ccdc57 mutants, in addition to within the central spinal canal (Fig 2C–2E). As well as, micro-CT evaluation confirmed the presence of dilated ventricles in ccdc57 mutant brains (Fig 2F).

thumbnail

Fig 2. Hydrocephalus in ccdc57 mutants.

(A, B) Exterior phenotypes of telencephalons in wild kind and ccdc57 mutant. Arrows level to the expanded ependymal epithelia as a result of extra CSF accumulation. (C) Diagram of the mind tissue in zebrafish displaying the websites of crossing part in numerous ventricles. CCe, corpus cerebelli; TeO, tectum opticum; CC, central canal; TecV, tectal ventricle; RV, rhombencephalic ventricle. (D) Histological cross-sections displaying ventricles (arrows) at totally different websites as indicated. (E) Bar graph displaying relative dimension of mind ventricles at totally different websites as indicated. (F) Micro-CT photos displaying the ventricles (arrows) in TecV and CC of untamed kind and mutant. (G) Diagram displaying the place of diencephalic choroid plexus (dChP) in grownup zebrafish. OB, olfactory bulb; Tel, telencephalon. (H, I) Three-dimensional reconstruction of dChP visualized with DAPI staining in wild kind and ccdc57 mutant. These nonetheless photos are from S1 Film and visualized from ventral aspect of the dChP. A, anterior; P, posterior. Scale bars: 100 μm in panels A and B, 1 mm in panel D, and 50 μm in panels H and I. The info underlying the graphs proven within the determine will be present in S1 Knowledge.


https://doi.org/10.1371/journal.pbio.3002008.g002

As described, CSF is produced by the CP. Subsequently, we additional examined the CP in wild kind and ccdc57 mutants specializing in the epithelial monolayer connecting the telencephalon and optic tectum generally known as the forebrain CP or diencephalic CP (dChP) [3638] (Fig 2G). Three-dimensional reconstructions of the dChP in wild kind zebrafish revealed a chapeau-like construction with a number of folds overlaying the mind tissues (Fig 2H and S1 Film). In distinction, ccdc57 mutant dChP appeared stretched and lacked foldings, as a result of extra CSF accumulation (Fig 2I and S2 Film). Subsequent, we investigated whether or not ccdc57 mutant larvae confirmed indicators of hydrocephalus. Injection of Rhodamine- or FITC-conjugated fluorescent beads into 2 or 3 dpf zebrafish larvae revealed no apparent variations within the mind ventricle dimension between mutants and siblings (S3 Fig). Collectively, these knowledge advised that, much like the late look of scoliosis, ccdc57 mutants developed hydrocephalus at later phases of improvement.

Planar polarity defects of cilia and basal our bodies in ccdc57 mutant ependymal cells

Extra accumulation of CSF in cerebral ventricles is without doubt one of the main causes of hydrocephalus. In zebrafish, directed CSF move is facilitated by the coordinated beating of motile cilia in multiciliated ependymal cells lining the mind ventricles. Specializing in the telencephalon and dChP areas, we recognized multiciliated cells largely restricted to the central portion of the ependymal layer (S4 Fig). Subsequent, we monitored motile cilia beating in these ependymal cells. In grownup wild kind zebrafish, all motile cilia bent to the route of the fluid move, and multicilia bundles beat synchronously (Fig 3A and S3 Film). In distinction, multicilia bent in quite a lot of instructions in ccdc57 mutants (Fig 3A and S4 Film). Even inside the similar ciliary bundle, particular person cilia beating appeared disorganized (S4 Film). We subsequent carried out scanning electron microscopy (SEM) analyses to visualise the ultrastructure of the ependymal cilia bundles. In comparison with the clustered distribution in wild kind fish, ciliary bundles appeared extremely disorganized in ccdc57 mutants (Fig 3B). Aberrant distribution of those ependymal cell ciliary bundles was additional confirmed through immunostaining with anti-glycylated tubulin antibody to visualise cilia (Fig 3C).

thumbnail

Fig 3. Mutation of ccdc57 leads to planar polarity defects in ependymal cells.

(A) Nonetheless photos displaying the beating route of motile cilia to drive fluid move (pink arrow) in grownup wild kind and mutants. The consultant kymographs of cilia motion have been proven on the backside. (B) Scanning electron microscopy displaying the multicilia of the ependymal cells in wild kind and ccdc57 mutant. (C) Confocal photos displaying cilia of the ependymal cells in wild kind and ccdc57 mutant as indicated. Cilia have been labeled with anti-mono-glycylated tubulin in inexperienced and the tight junction have been stained with Claudin-5 antibody in crimson. Nuclei have been counterstained with DAPI. (D) Confocal photos displaying the basal physique distribution within the ependymal cells of untamed kind and ccdc57 mutant as indicated. The basal our bodies have been labeled with anti-γ tubulin in inexperienced and cytoskeleton was stained with phalloidin in purple. Tight junctions have been stained with Claudin-5 antibody in crimson. Nuclei have been counterstained with DAPI. Arrows point out the displacement of basal our bodies from the middle of the cells. The schematic diagram of the displacement of basal our bodies have been proven on the backside. (E) Angular distribution of the basal our bodies in ependymal cells from wild kind and ccdc57 mutant. (F) Statistical evaluation displaying relative displacement distance of basal our bodies from heart of the cell. (G) Statistical evaluation displaying the variety of basal our bodies in every ependymal cell of untamed kind and ccdc57 mutant. (H) Mannequin illustrating the distribution of multicilia on ependymal cells of untamed kind and ccdc57 mutant. All the info analyzed on this determine are generated from 3- to 4-months-old grownup zebrafish. Scale bars: 5 μm in panels B and D; 7.5 μm in panel C. The info underlying the graphs proven within the determine will be present in S1 Knowledge.


https://doi.org/10.1371/journal.pbio.3002008.g003

Cilia are anchored to the floor of ependymal cells by basal our bodies. We subsequently investigated basal physique localization in wild kind and ccdc57 mutant ependymal cells. In wild kind zebrafish, basal our bodies appeared localized to the identical aspect of every ependymal cell (Fig 3D and 3E). In distinction, basal our bodies have been randomly distributed in ccdc57 mutants, with many localized to the middle area of ependymal cells, indicating polarity defects within the absence of Ccdc57 (Fig 3D–3F). Notably, the variety of basal our bodies was comparable between mutant and wild kind ependymal cells (Fig 3G). Subsequent, we characterised the basal our bodies of ependymal cells contained in the ChP. In wild kind zebrafish, multiciliated ependymal cells primarily localized to the middle of the folds of the ChP (S5A and S5B Fig and S5 and S6 Motion pictures). Of observe, wild kind ChP ependymal cells additionally exhibited planar polarity in basal physique distribution (S5C Fig), and this planar polarity was absent in ccdc57 mutant ChP ependymal cells (S5C–S5E Fig). Collectively, these knowledge advised that lack of Ccdc57 resulted in irregular distribution of multicilia within the ependymal cells, along with basal physique planar polarity defects (Fig 3H).

Cell polarity defects of ccdc57 mutant ependymal cells

We subsequent requested whether or not ependymal cell polarity was affected within the absence of Ccdc57. Since basal our bodies depend on the cytoskeleton microtubule community to localize cilia, the misplacement of basal our bodies in ccdc57 mutants could also be as a result of irregular group of cytoskeletal microtubules. We subsequently examined the cytoskeleton utilizing alpha tubulin antibody staining and located that the microtubule skeleton appeared disorganized in ccdc57 mutants as in comparison with the extremely polarized microtubule community in wild kind cells (S6A and S6B Fig). The place of mitochondria additionally depends upon the microtubule community, we additional analyzed the distribution of ependymal cell mitochondria utilizing Tom20 staining. Our outcomes confirmed that ccdc57 mutant ependymal cells displayed irregular mitochondria distribution patterns as in contrast with these of untamed kind cells (S6C and S6D Fig).

We subsequent examined the form of ependymal cells through Claudin-5 antibody-labeled mobile tight junctions. At 3 months postfertilization (mpf), wild kind zebrafish ependymal cells appeared symmetrically distributed all through the ependymal layer, with slim and elongated cells situated within the heart and bigger spherical cells situated laterally (Fig 4A and 4B). Furthermore, the elongated cell axes have been parallel to the anterior–posterior axis, indicating polarity of those cells (Fig 4C). Intriguingly, the symmetrical distribution sample of ependymal cells was additionally discovered to be established in 17 dpf wild kind zebrafish larvae (Fig 4D–4F). In distinction, polarized ependymal epithelial cell group was severely disrupted in 3 mpf ccdc57 mutants (Fig 4B and 4C). At 17 dpf when backbone curvatures are first obvious, ccdc57 mutants additionally exhibited abnormal-shaped ependymal cells within the central area, suggesting an earlier defect of ependymal cell polarity (Fig 4E and 4F). Notably, since a number of motile cilia formation doesn’t happen till 1 mpf (Fig 4G) [38], these outcomes advised that Ccdc57 participates within the regulation of ependymal cell polarity in early zebrafish improvement, in addition to in later developmental basal physique positioning.

thumbnail

Fig 4. Lack of Ccdc57 leads to ependymal cell polarity defects.

(A, B) Distribution sample of ependymal cells in 3-months-old wild kind and ccdc57 mutant as indicated with tight junction marker Claudin-5 staining. Nuclei have been counterstained with DAPI in blue. The displayed area of ependymal epithelia was indicated in panel A. Heatmap displaying the relative dimension of every ependymal cells as displayed within the confocal photos. (C) Statistical evaluation displaying orientation of the midline ependymal cells alongside the anterior–posterior (A–P) axis in wild kind and ccdc57 mutant. The angles between the longer axis of every midline ependymal cells and the A–P axis have been used to guage cell polarity with 0 diploma indicating horizontal cell. (D, E) Distribution sample of ependymal cells within the brains of 17 dpf wild kind and ccdc57 mutant. (F) Statistical evaluation displaying orientation of the midline ependymal cells in wild kind and mutant as indicated. (G) Confocal photos displaying the ependymal layer labeled with Claudin-5 (crimson) and glycylated tubulin (inexperienced) antibodies in 25 and 30 dpf wt and ccdc57 mutants. Nuclei have been counterstained with DAPI. Scale bars: 25 μm in panel B; 50 μm in panel E; 50 μm in panel G. The info underlying the graphs proven within the determine will be present in S1 Knowledge.


https://doi.org/10.1371/journal.pbio.3002008.g004

Ccdc57 orchestrates the synchronized beating of motile cilia within the spinal canal

Throughout larval zebrafish improvement, ependymal cells are derived from radial glial cells, which are also concerned in establishing their translational cell polarity [31]. Subsequently, we subsequent requested whether or not radial glial cilia have been faulty within the absence of Ccdc57. At larvae phases, spinal canal ependymal cells are a specialised kind of radial glia harboring main motile cilia that drive CSF move. In ccdc57 mutants, the quantity and size of spinal canal cilia have been corresponding to these of untamed kind larvae (S2E and S2F Fig). Additional examination of cilia localization by immunostaining with anti γ-tubulin antibody confirmed that each wild kind and ccdc57 mutant cilia have been localized to the posterior apical floor of every radial glia cell within the spinal canal, with no obvious variations in basal physique localization (Fig 5A and 5B).

thumbnail

Fig 5. Ccdc57 orchestrates synchronized beating of motile cilia within the central canal.

(A) Confocal photos displaying the localization of basal our bodies within the ground plate cells at 2 dpf and 5 dpf. Basal our bodies have been stained with anti-γ tubulin (gama-Tub, inexperienced) antibody, and nuclei have been counterstained with DAPI in blue. The white dotted line connects the middle of cells. (B) Statistical evaluation displaying the angles of basal our bodies with the anterior–posterior (A–P) axis as illustrated within the diagram. (C) Nonetheless photos displaying kymographs of ground plate cilia motion in 5 dpf of untamed kind and ccdc57 mutant. (D) Beating frequency of ground plate cilia in wild kind and ccdc57 mutants. (E) Statistical evaluation displaying the rotation angles of cilia in ground plate. The anterior and posterior angles have been measured as illustrated within the diagram. (F, G) Relative tilting instructions of ground plate cilia in wild kind and ccdc57 mutants. The tilting route was evaluated by the bisector of every angles. (H) Confocal photos displaying relative localization of Dvl protein (inexperienced) and basal physique (gama-Tub, crimson) in ground plate cells. (I, J) Subcellular localization of Dvl protein (inexperienced) within the ground plate ependymal cells. The statistical outcomes have been proven in panel J. (Ok) Confocal photos displaying the localization of GFP-Prickle (inexperienced) in ground plate ependymal cells as indicated. (L) Confocal photos displaying the distribution of Dvl protein (inexperienced) on ependymal cells of grownup zebrafish. The displacement distance of Dvl vesicles was additionally proven on the proper. Scale bars: 5 μm in panel A; 5 μm in panels H and I; 10 μm in panel Ok; 7.5 μm in panel L. The info underlying the graphs proven within the determine will be present in S1 Knowledge.


https://doi.org/10.1371/journal.pbio.3002008.g005

We subsequent examined the beating sample of those spinal canal cilia utilizing excessive velocity video microscopy. By imaging cilia motility within the caudal central canal of 5 dpf wild kind larvae, we discovered that all the cilia beat in the same method, and a synchronized beating wave was simply noticed all through the sector of view (Fig 5C and S7 Film). Nevertheless, the orchestrated ciliary beating was disrupted in ccdc57 mutant spinal cords, with particular person cilia beating independently of each other (Fig 5C and S8 Film). Of observe, the beating frequency of particular person cilia was comparable between ccdc57 mutant and wild kind larvae (Fig 5D). Ciliary beating angle measurements demonstrated that the beating angle elevated considerably in ccdc57 mutants as in comparison with wild kind siblings (Fig 5E). We additional used the bisector of every angle to guage the tilting route of motile cilia and located that the tilting angles have been considerably elevated in ccdc57 mutants (cat. 72.11° ± 14.16° in wild kind versus 85.52° ± 5.06° in mutants) (Fig 5F and 5G).

To additional discover the beating defects of spinal canal cilia, we carried out fluorescent bead tracing experiments at totally different phases of zebrafish improvement. By monitoring the motion of fluorescent beads injected into the central canal, we noticed bidirectional CSF move, as proven beforehand, within the central canal of untamed kind larvae at each 30 hpf and three dpf [39,40] (S9 and S11 Motion pictures). The bidirectional CSF move was largely maintained in ccdc57 mutants, though residential round particle actions have been additionally noticed (S10 and S12 Motion pictures). Strikingly, we seen that the injected fluorescent beads have been in a position to be transported to the tip of the central canal by 6 hours postinjection (hpi) within the majority of untamed kind larvae, whereas not one of the ccdc57 mutants contained fluorescent beads within the caudal spinal canal, and the fluorescent bead transport distances have been considerably decreased (S7 Fig). The bead transport defects have been noticed in ccdc57 mutants in any respect phases analyzed (3 dpf, 5 dpf, and 17 dpf) (S7 Fig). Collectively, these knowledge recommend that Ccdc57 orchestrates the synchronized beating of spinal canal motile cilia, whose deficiency results in irregular CSF-flow.

Localization of core PCP elements in ccdc57 mutants

The posterior tilting of spinal canal motile cilia is especially regulated by the PCP pathway [41]. To additional characterize this phenomenon, we examined the localization of two main PCP pathway elements, Prickle and Dishevelled 1 (Dvl1), in wild kind and ccdc57 mutant fish. Just like their basal our bodies, Dvl1 appeared localized to the apical posterior area of every radial glia cell (Fig 5H), with Dvl1-positive vesicles localized to the area surrounding the basal our bodies (Fig 5H). Noticeably, the Dvl1 distribution angles have been comparable between ccdc57 mutants and wild kind management embryos (Fig 5I and 5J). The localization of Prickle was reverse to that of Dvl1 vesicles, within the anterior apical floor, as demonstrated by GFP-Prickle labeling. The Prickle localization was comparable in wild kind and ccdc57 mutants (Fig 5K). These knowledge advised that localization of PCP elements in larval zebrafish was not affected by the absence of Ccdc57. Intriguingly, in grownup zebrafish, Dvl1 expressing vesicles appeared localized to at least one aspect of mature ependymal cells, akin to the placement the place multicilia fashioned (Fig 5L). In distinction, in grownup ccdc57 mutants, Dvl1 expressing vesicles appeared dispersed randomly all through your complete cell, clearly indicating a late onset cell polarity defect in ccdc57 mutants (Fig 5L).

CCDC57 encodes a centrosomal satellite tv for pc protein required for cell polarity

To disclose the mechanisms of Ccdc57 regulation of basal physique positioning, we additional examined the subcellular localization of CCDC57 in RPE-1 cells. Just like earlier experiences, CCDC57 primarily localized to centriolar satellites in RPE-1 cells [42]. Flag-tagged CCDC57 protein colocalized with centriolar satellite tv for pc proteins OFD1 and PCM1 and didn’t localize to cilia (ARL13B) or to the distal appendage of the basal physique (CEP164) (Fig 6A–6C). Mass spectrometry evaluation of pulled-down proteins utilizing Anti-FLAG conjugated beads confirmed that CCDC57 interacted with a number of centrosomal proteins, together with CEP170, OFD1, and CP110 (Fig 6D), and we additional validated the CCDC57-OFD1 interactions through immunoprecipitation (Fig 6E). Furthermore, siRNA knockdown of OFD1 eradicated localization of CCDC57 to the centriolar satellite tv for pc. In distinction, siRNA knockdown of CCDC57 gene expression had no impact on centrosomal localization of OFD1(Fig 6F).

thumbnail

Fig 6. CCDC57 is a centrosomal satellite tv for pc protein required for cell polarity.

(AC) Confocal photos displaying the relative localization of CCDC57 with OFD1, PCM1, CEP164, and ARL13B in RPE-1 cells. (D) Mass spectrometry evaluation of the CCDC57 interacting proteins. (E) Immunoprecipitation outcomes displaying the interplay between CCDC57 and OFD1. (F) Confocal photos displaying the localization of CCDC57 and OFD1 in siRNA knockdown RPE-1 cells. (G) Scratch-wound assay displaying the polarized localization of Golgi (GM130, inexperienced) throughout directional cell migration in management and CCDC57 siRNA-treated cells. (H) Mannequin illustrating the statistical evaluation of cell polarity by Golgi place. (I) Dot plots displaying the angles of Golgi dealing with the migration edge in management and CCDC57 siRNA-treated cells. (J, Ok) Photos displaying the cell migration state and statistical evaluation of the migration distance. In all panels, nuclei have been counterstained with DAPI in blue. Scale bars: 2.5 μm in panel A; 5 μm in panel B; 3 μm in panel C; 5 μm in panel F; 50 μm in panel G. The info underlying the graphs proven within the determine will be present in S1 Knowledge.


https://doi.org/10.1371/journal.pbio.3002008.g006

Throughout migration, cells can set up a entrance–rear polarity characterised by the polarized distribution of Golgi and centrosomes in the forefront [43]. We subsequently additional examined the position of CCDC57 in establishing cell polarity in RPE-1 cells by wound-scratch assay. After scratching, the microtubule cytoskeleton of vanguard RPE-1 cells appeared polarized, with the Golgi dealing with towards the scratched area to direct cell migration. In management siRNA-treated RPE-1 cells, the vast majority of vanguard cells contained Golgi equipment situated inside 60 levels of the route of migration relative to the nucleus (Fig 6G–6I). In distinction, the polarized orientation of Golgi equipment was considerably compromised in CCDC57 siRNA-treated RPE-1 cells, as demonstrated by considerably elevated orientation angles (Fig 6G–6I). Moreover, migration distance was additionally decreased in CCDC57 siRNA-treated cells as in comparison with management siRNA-treated cells (Fig 6J and 6K). Collectively, these in vitro research additional confirmed the position of the centrosomal protein, CCDC57, in establishing cell polarity.

Irregular RF meeting and urotensin expression in ccdc57 mutant larvae

We subsequent sought to establish the causes of the physique curvature noticed in ccdc57 mutants. Epinephrine indicators are important for urotensin expression and physique straightening [8]. In keeping with this, epinephrine remedy was additionally in a position to rescue physique curvature in ccdc57 mutant embryos (S8 Fig). The RF is crucial for physique axis straightening by transferring the epinephrine indicators to the CSF-cNs [20,21]. We discovered that wheat germ agglutinin (WGA) can be utilized to label and picture the RF (S9A–S9C Fig). In varied ciliary mutants, WGA-labeled RF appeared both discontinuous or absent (S9D–S9G Fig). Equally, WGA staining of the RF was additionally diminished or absent in ccdc57 mutant larvae (Fig 7A). Apparently, physique curvature severity intently correlated with the severity of RF meeting defects in ccdc57 or kif3a mutants (S9H–S9M Fig). Subsequent, we examined the expression of urotensins in ccdc57 mutant larvae utilizing whole-mount in situ hybridization (WISH) evaluation. Whereas urp1 expression appeared comparatively regular within the anterior trunk of ccdc57 mutant larvae, the variety of urp1-expressing cells was markedly decreased within the posterior trunk (Fig 7B and 7C). Collectively, these knowledge advised that Ccdc57 deficiency interrupts meeting of the RF and down-regulates the expression of urotensin genes. The truth that variations in urotensin gene expression primarily occurred within the posterior trunk could clarify why ccdc57 mutant larvae exhibit solely gentle physique curvature.

thumbnail

Fig 7. Mutation of ccdc57 leads to RF defects and irregular expression of Urotensins within the spinal wire.

(A) Consultant photos of Reissner fiber (RF, white arrows) in 2 dpf wild kind and ccdc57 mutant larvae. cc, central canal; nc, notochord; fp, ground plate. (B) Entire-mount in situ hybridization outcomes displaying the expression of urp1 in 24 hpf management and ccdc57 mutant larvae as indicated. The enlarged views of the staining within the posterior area are proven within the backside. (C) Statistical evaluation displaying the variety of urp1-expressing cells within the anterior and posterior a part of the trunk. (D) Confocal photos displaying RF (white arrow) in wild kind and ccdc57 grownup mutants. RF was stained with wheat germ agglutinin (WGA, crimson), and nuclei have been counterstained with DAPI. (E) qPCR evaluation displaying the expression of urotensin genes (urp1 and urp2) in numerous components of the grownup trunk as illustrated within the diagram. (F) In situ hybridization outcomes displaying the expression of urp2 within the brains of grownup wild kind and ccdc57 mutant as indicated. Arrows level to the expression of urp2 within the posterior a part of the mind. (G) In situ hybridization outcomes displaying the expression of urp2 within the spinal wire of untamed kind and ccdc57 mutant as indicated. The purple arrowhead signifies the websites of enriched urp2 expression. (H) The road graphs displaying the relative optical density of the expression of urp2 in wild kind and ccdc57 mutants. (I) Mannequin illustrating the distribution of urp2 in wild kind and ccdc57 mutant. Scale bars: 7.5 μm in panel A; 10 μm in panel D. The info underlying the graphs proven within the determine will be present in S1 Knowledge.


https://doi.org/10.1371/journal.pbio.3002008.g007

Ectopic accumulation of Urotensin neuropeptides in ccdc57 grownup mutants

Subsequent, we tried to find the connection between the event of scoliosis and CSF move defects. First, we investigated the meeting of the RF in wild kind and ccdc57 mutants, based mostly on the beforehand characterised roles for the RF in regulating physique axis improvement [10,19,22]. In wild kind adults, the RF appeared thick and straight (Fig 7D). In distinction, the RF appeared a lot thinner, discontinuous, and/or absent in grownup ccdc57 mutants (Fig 7D). Of observe, the severity of RF meeting defects correlated with the extent of scoliosis within the mutants (S10A and S10B Fig). Subsequent, we centered on the expression of urotensin neuropeptides. Intriguingly, we discovered that from a lateral view, grownup ccdc57 mutant spines all the time contained a powerful dorsal bending within the anterior trunk and a second dorsal bending within the tail area (Fig 1B and 1E). To raised characterize this function, we dissected grownup wild kind and ccdc57 mutant trunks into three segments (Head, Center, and Tail) and remoted whole RNA from every section (Fig 7E). Unexpectedly, qPCR outcomes confirmed that the expression of urp1 and urp2, the foremost urotensins regulated by CSF signaling, was elevated over roughly 10 instances within the Head segments of ccdc57 mutants as in contrast with these of untamed kind management siblings (Fig 7E). In distinction, Center trunk segments displayed decrease expression ranges of those genes in ccdc57 mutants, whereas urotensin expression once more appeared up-regulated in Tail segments of ccdc57 mutant grownup spines (Fig 7E). To additional validate these outcomes, we carried out ISH evaluation on dissected spinal cords for the expression of urp2, one of many main urotensin genes expressed at later phases. Our outcomes confirmed that the expression of urp2 was dramatically elevated within the brainstem area of ccdc57 mutants (Fig 7F). In distinction, urp2 expression was just about absent within the center a part of the backbone, with some urp2 expression noticed within the tail area (Fig 7G and 7H). To additional study whether or not urp2 expression within the tail area correlated with the second dorsal bending of the backbone, we dissected the spinal wire on the second bending web site and additional reduce it on the apex into anterior and posterior fragments (S10C Fig). Apparently, in contrast with wild kind management siblings, urp2 gene expression was up-regulated within the posterior fragment of the dissected spinal wire, whereas urp2 was not detected within the anterior fragment (S10C Fig). Collectively, these outcomes recommend an attention-grabbing relationship between urp2 expression and spinal curvature (Fig 7I).

Correlation between urotensin expression and backbone curvature in ciliary mutants

To additional gauge the connection between urotensin expression and spinal curvature, we evaluated backbone curvature phenotypes in a number of zebrafish scoliosis mutants. Each tmem67 and ofd1 mutants displayed scoliosis. Micro-CT outcomes confirmed that these mutants additionally displayed preliminary dorsal bending within the anterior backbone (Fig 8A). The noticed scoliosis in ofd1 and ccdc57 mutants additional demonstrated the interactions between Ofd1 and Ccdc57 that have been revealed by our IP pulldown experiments (Fig 6E). Of observe, qPCR outcomes confirmed the improved expression of urp1 and urp2 within the anterior spines of ccdc57, tmem67, and ofd1 mutants (Fig 8B).

thumbnail

Fig 8. Ectopic accumulation of urotensin neuropeptides is related to backbone curvature in zebrafish ciliary mutants.

(A) Consultant photos of untamed kind and scoliosis zebrafish mutants. Micro-CT photos are proven on the underside. (B) qPCR evaluation displaying the expression of urotensin genes within the heads of untamed kind and scoliosis mutants. (C) Enlarged views of the top areas of untamed kind, ccdc57, and uts2r3 mutants. (D, E) Statistical evaluation of the dorsal curvature angles in numerous mutants as indicated. The angles have been measured between the route of the parasphenoid bone and the Weberian vertebrae as illustrated within the diagram (D). (F) In situ hybridization outcomes displaying the expression of urp2 within the brains of untamed kind and uts2r3 mutant as indicated. (G) Expression of urp2 within the spinal cords of untamed kind and uts2r3 mutant. The strongly elevated expression of the urp2 within the tail area was proven on the enlarged views. (H) Dissected spinal cords from wild kind and uts2r3 mutants as indicated. The 2 boxed areas correspond to these in panel G. Scale bars: 1 cm in panels A and H. The info underlying the graphs proven within the determine will be present in S1 Knowledge.


https://doi.org/10.1371/journal.pbio.3002008.g008

Now we have beforehand proven that mutation of uts2r3, the foremost Urotensin receptor, results in scoliosis. Noticeably, the spinal curvature of uts2r3 mutants was clearly totally different from that of ciliary mutants. The anterior dorsal bending phenotype appeared comparatively minor in uts2r3 mutants, whereas all uts2r3 mutants bent to the ventral aspect first, and displayed robust dorsal bending within the posterior portion of the trunk (Fig 8A). To raised characterize spinal bending, we measured the angle between the parasphenoid bone and the Weberian vertebrae orientation in wild kind, ccdc57, and uts2r3 mutants (Fig 8C). The measured angles of ccdc57 mutants have been considerably bigger than these in management and uts2r3 mutants (Fig 8C–8E). In line with these outcomes, urp2 expression ranges have been dramatically elevated within the anterior spines of ccdc57 mutants, whereas solely a slight enhance was noticed in uts2r3 mutants (Fig 8B), as validated through WISH assay (Fig 8F). Noticeably, the placement of elevated urp2 expression in uts2r3 mutant spines additionally correlated with the noticed second bending in uts2r3 mutant spines (Fig 8G and 8H). Collectively, these knowledge present robust proof that spinal bending intently correlates with the activation of Urotensin signaling.

Irregular urotensin indicators in idiopathic scoliosis sufferers

Lastly, we sought to analyze whether or not urotensin signaling can also be concerned within the regulation of spinal curvature in human scoliosis sufferers. Though it’s troublesome to acquire scoliosis affected person spinal wire tissue for evaluation, we have been in a position to accumulate bilateral paravertebral muscle tissue from scoliosis sufferers throughout surgical procedure. We then in contrast Urotensin signaling pathway gene expression in paravertebral muscle tissue harvested from the convex and concave sides of spinal curvature websites (Fig 9A). Strikingly, though UTS2 expression appeared comparable between convex and concave muscle tissue areas, we noticed a remarkably uneven expression of UTS2R in bilateral paravertebral muscle mass of AIS sufferers (n = 46) (Fig 9B and 9C). The expression of UTS2R was considerably larger in convex aspect as in comparison with concave aspect muscle tissue (Fig 9B). In response to the ratio of UTS2R expression within the convex versus the concave (convex/concave), we categorised these AIS sufferers into two teams with the ratio of two as cutoff level. Strikingly, sufferers with >2-fold distinction in expression (n = 26) had remarkably extreme curvature magnitude as in comparison with sufferers with <2-fold distinction (n = 20) (58.62 ± 9.48 levels versus 51.35 ± 6.58 levels) (Fig 9D and 9E). Thus, these knowledge strongly help the speculation that irregular Urotensin signaling could make a big contribution to the severity of spinal curvature noticed in AIS sufferers.

thumbnail

Fig 9. Irregular urotensin indicators in adolescent idiopathic scoliosis (AIS) sufferers.

(A) Diagram indicating the place of bilateral paravertebral muscle mass harvested from AIS sufferers. (B, C) Relative expression of UTS2R and UTS2 in bilateral paravertebral muscle mass of AIS sufferers (n = 46). (D) Distribution of Cobb angles inside the two teams of AIS sufferers exhibiting a ratio of UTS2R expression on the convex versus concave sides higher (>) or much less (<) than 2. (E) Consultant X-ray photos displaying two AIS sufferers with convex/concave ratios higher (5.21) or lower than 2 (1.24). Measurements of Cobb angles are additionally indicated. The info underlying the graphs proven within the determine will be present in S1 Knowledge.


https://doi.org/10.1371/journal.pbio.3002008.g009

In abstract, right here we confirmed that Ccdc57 is a centrosomal protein required for the correct institution of basal physique and cilia polarity. Lack of Ccdc57 disrupted the planar polarity of ependymal cells, affected the polarity and beating sample of cilia current in each radial glial and ependymal cells, and led to CSF move defects. The CSF move defects resulted within the up-regulation of Urotensin indicators within the anterior portion of the backbone, ultimately resulting in spinal dorsal bending and scoliosis.

Dialogue

Scoliosis is without doubt one of the most typical illnesses identified in childhood or early adolescence, though the underlying causes stay largely unknown. Current research recommend that along with environmental components, underlying genetic components additionally contribute to the incidence of spinal curvatures. The coincidence of scoliosis and hydrocephalus in a number of human genetic issues suggests a possible relationship between hydrocephalus and spinal curvature improvement. Equally, hydrocephalus is continually noticed in zebrafish ciliary scoliosis mutants. Remarkably, the curvature of the backbone will not be obvious till roughly 3 weeks fertilization in just about all zebrafish ciliary mutants, which factors to an attention-grabbing query: Why does irregular backbone curvature develop at these phases? On this paper, we current knowledge displaying that deficiency of the centrosomal protein, Ccdc57, leads to scoliosis in zebrafish. Our knowledge recommend that decreased Ccdc57 expression leads to ependymal cell polarity defects as early as 17 dpf, which, in flip, have an effect on the coordinated beating of ependymal cell multicilia and CSF move. Furthermore, the next accumulation of CSF causes up-regulation of the Urotensin expression within the anterior backbone, which contributes to the preliminary backbone curvature formation.

In mouse, multiciliated ependymal cells show planar polarity in three distinct ranges: the route of cilia beating generally known as rotational polarity; the displacement of cilia through the basal physique positioning generally known as translational polarity; and the alignment of ciliary basal our bodies on the intercellular stage generally known as tissue polarity [44]. Equally, our knowledge recommend that multiciliated ependymal cells additionally displayed these three forms of polarities in zebrafish. In wild kind zebrafish, most basal our bodies appeared localized to the identical aspect of particular person ependymal cells. In ccdc57 mutants, each basal physique placement and coordinated cilia beating have been disrupted in ependymal cells. Noticeably, synchronized cilia motility can happen on the mobile (every particular person cilium) and intercellular (cilia bundle) ranges, and each have been affected within the absence of Ccdc57. The beating route of cilia is intently associated to the orientation of the basal foot, an adjunct construction projecting from the aspect of the basal physique. Inside every ependymal cell, the basal toes are aligned in direction of the route of cilia beating [45]. Contemplating the subcellular localization of CCDC57, it’s conceivable that Ccdc57 deficiency could result in misalignment of ependymal cell basal toes. Furthermore, the rotational orientation of cilia can also be regulated by a number of PCP-core modules together with Frizzled, Van Gogh-like (Vangl1/2), and Prickle. PCP of ependymal cells is first established by the uneven localization of those core PCP elements through a polarized microtubule community, which additional organizes the distribution of ciliary basal our bodies in a PCP-dependent method [32,4648]. Apparently, whereas the distribution of the PCP proteins Dvl1 and Prickle was initially regular within the radial glial cells of larval mutants, grownup ccdc57 mutants confirmed disorganized basal physique distribution, suggesting that Ccdc57 could operate downstream of PCP elements to control basal physique positioning. Lastly, ccdc57 mutant ependymal cells displayed irregular cell polarity characterised by microtubule polarity defects, which occurred earlier than the maturation of multiciliated cells. These knowledge recommend that organizational defects within the microtubule community have been upstream of the noticed irregular basal physique distribution in ccdc57 mutants. Ccdc57 could regulate the polarity of the microtubule community through its microtubule binding area [42]. Because the basal foot additionally participates within the regulation of the polarity of microtubule community [49,50], Ccdc57 can also management the basal physique polarity to arrange the microtubule community. Within the absence of Ccdc57, the microtubule community polarity is flawed, leading to later defects of irregular cilia beating and basal physique positioning.

Defects in motile cilia of the mind ventricles are related to hydrocephalus in people, mice, and zebrafish. Whereas ccdc57 mutants displayed robust hydrocephalus and multiciliated cell defects, it’s shocking that mind morphology appeared comparatively regular in gmnc zebrafish mutants that lack multiciliated cells [38,51] (S11A–S11C Fig). Furthermore, gmnc mutants didn’t exhibit scoliosis, suggesting that faulty multicilia weren’t the prerequisite for CSF move defects and the development of scoliosis (S11D Fig). In distinction to ccdc57 mutants, coordinated single motile ciliary beating was comparatively regular in gmnc mutants (S11E Fig and S13 and S14 Motion pictures), which, along with heartbeat and physique actions, ensured enough circulation of CSF within the CNS [52]. In keeping with this, the RF additionally developed usually in gmnc mutants (S11F Fig). In grownup gmnc mutants, though multicilia weren’t differentiated as demonstrated by the localization of basal our bodies, the polarity displacement of main motile cilia remained largely regular (S11G Fig). Furthermore, the distribution sample of ependymal cells additionally appeared comparatively regular, as in comparison with the severely disorganized sample noticed in ccdc57 mutants (S11H Fig). Subsequently, it’s possible that the only motile cilia in gmnc mutant ependymal cells are enough to drive CSF move. In distinction, coordinated ciliary beating is crucial to stop the event of hydrocephalus. In ccdc57 mutants, the PCP defects resulted in dampened directional CSF move as a result of lack of coordinated beating of particular person cilium within the ependymal cells. The CSF move defects additional resulted in CSF accumulation within the mind ventricles, resulting in hydrocephalus. It’s noteworthy that hydrocephalus varieties from the cumulative results of faulty CSF move, as solely a small variety of ccdc57 mutant larvae exhibited hydrocephalus at 17 dpf when spinal curvature was initially noticed (S12A and S12B Fig). In distinction, the width of spinal canal was considerably elevated within the mutants ranging from as early as 3 dpf (S12C and S12D Fig), an earlier signal of CSF move defects.

In abstract, we return to our query: How does hydrocephalus end in scoliosis? We discovered that ependymal cell polarity defects in ccdc57 mutants first occurred at roughly 17 days after fertilization, previous to the formation of differentiated multicilia. Apparently, scoliosis was additionally first obvious at this developmental stage, suggesting a possible relationship between cell polarity defects and scoliosis. Now we have proven beforehand that the Urotensin indicators govern zebrafish physique axis straightening by activating its receptors situated in dorsal muscle fiber cells [8]. Analyses of dissected antero-posterior parts of grownup ccdc57 mutant spines revealed that the expression of Urotensin neuropeptides was considerably up-regulated within the head area. In ccdc57 mutants, CSF move defects led to hydrocephalus and extra accumulation of CSF within the mind ventricles. The noticed enhanced expression of urp2 within the hindbrain could also be attributable to up-regulation of epinephrine signaling within the mind ventricles as a result of CSF accumulation. Apparently, we discovered that each one ccdc57 mutants developed dorsal curvature within the anterior a part of the backbone. Since Urotensin indicators can promote the contraction of dorsal muscle fibers, it’s potential that the anterior-most, first dorsal curvature was the results of enhanced urp2 expression on this area. In truth, nearly all reported zebrafish ciliary scoliosis mutants displayed a primary dorsal curvature phenotype [6,22,53,54]. In distinction, uts2r3 mutants that lack urotensin receptors displayed minor dorsal bending within the anterior portion. Of observe, the second dorsal bending of the ccdc57 mutants noticed within the posterior portion of the trunk additionally corresponded to enhanced urp2 expression. It’s possible that these secreted neuropeptides activate the contraction of muscle fibers regionally and that the uneven distribution of Urotensin neuropeptides in ccdc57 mutant leads to unbalanced muscle contraction surrounding the backbone, ultimately resulting in scoliosis.

Lastly, knowledge obtained from human AIS sufferers advised that Urotensin indicators have been additionally differentially activated between the convex and concave sides of the backbone in these sufferers. Apparently, the noticed up-regulation of UTS2R expression in AIS sufferers additionally occurred on the convex aspect of the backbone, much like the up-regulation of urp2 noticed within the dorsal bending websites of zebrafish mutant spines. It’s noteworthy that we didn’t observe differential expression of urotensin neuropeptides between the convex and concave spinal muscle tissues of AIS sufferers. We imagine this consequence could also be as a result of the truth that AIS affected person tissues have been collected from paravertebral muscle mass that have been enriched for the expression of UTS2R, however not for the neuropeptides, that are primarily secreted from the neurons.

Altogether, our knowledge recommend that ependymal polarity defects are the earliest signal of scoliosis improvement in zebrafish ciliary mutants, and we offer one clarification for the way scoliosis develops in zebrafish ciliary mutants, which can present new perception into mechanisms regulating scoliosis in people.

Supplies and strategies

Immunofluorescence assay

Immunostaining of whole-mount larvae was carried out utilizing commonplace protocols [59]. For immunofluorescence of ependymal cells, the mind was first dissected from grownup zebrafish after which fastened in Dent’s fixative (80% methanol and 20% dimethylsulfoxide). Fastened brains have been incubated with main antibodies in a single day at 4°C, adopted by washing 3 instances with PBST at 4°C, then incubated with secondary antibody in a single day at 4°C. Immunostained grownup zebrafish ependymal cell layer tissues have been fastidiously collected with tweezers for imaging. The ependymal cell tissues of zebrafish lower than 1 month previous have been imaged immediately and didn’t require dissection from the mind.

For RF staining, 48 hpf zebrafish larvae have been fastened in Dent’s fixative in a single day at 4°C, washed 3 instances with 1 X PBS, then incubated with WGA dissolved in PBS (1,200) in a single day at 4°C. After 4 instances wash with 1X PBS, the samples have been imaged with Leica Sp8 confocal microscope. For staining in grownup zebrafish, the spinal wire was first dissected, fastened in 4% PFA in a single day at 4°C, and additional processed for WGA staining. After staining, the tissues surrounding the spinal wire have been eliminated to show the RF for imaging.

The next antibodies have been used: anti-glycylated tubulin (1:500, EMD); anti-γ-tubulin (1:500, Sigma); anti-cldn5 (1:250, Thermo Fisher Scientific); anti-DVL1 (1:200, BiCell Scientific); anti-TOM20 (1:500, Abcam); anti-alpha-tubulin (1:500, Sigma); anti-polyglutamylated tubulin (1:500, Adipogen); and WGA (1:200, Invitrogen).

Immunofluorescence microscopy of cultured cells

The strategies used have been as beforehand described [60]. Briefly, cells grown on coverslips have been fastened with 4% PFA for 10 minutes at room temperature after which permeated by chilly methanol for 10 minutes at −20°C. After washing with PBS, the cells have been incubated with the first antibodies at room temperature for 1 hour. After washing twice with PBS, cells have been incubated with secondary antibodies and 4′, 6-diamidino-2-phenylindole (DAPI) for 1 hour in darkish. After washing 3 instances with PBS, the coverslips have been mounted with mounting buffer (S36963, Invitrogen). All antibodies have been diluted in blocking buffer (1% BSA in PBS). Photos have been acquired utilizing laser scanning confocal microscope (FV3000, Olympus) with a 40× oil-immersion goal. ImageJ software program was used for quantification. For IF, the next antibodies have been used: mouse anti-flag (1:1,000, Sigma-Aldrich); rabbit anti-PCM1(1:1,000, Cell Signaling Expertise); rabbit anti-CEP164 (1:4,000, Proteintech); and OFD1 (1:5,000, selfmade).

Pharmaceutical therapies and whole-mount in situ hybridization

Epinephrine (Sigma) remedy was carried out as beforehand described [8]. Briefly, mutant and management zebrafish embryos have been incubated with epinephrine (10 mg/ml) from bud stage till evaluation. Photos have been captured utilizing a Leica M165FC microscope. WISH was carried out based on commonplace protocols. The next primers have been used for in situ hybridization: urp1 ahead: 5′-ACATTCTGGCTGTGGTTTG-3′, reverse: 5′- TGTATGGGGAAAACAAAGG-3′; urp2 ahead: 5′-CAGCCCAAATAACAGAGACAAGAG-3′, reverse: 5′- AGAGGGTCAGTCGTGTTATTGAGG -3′.

Fluorescent beads tracing experiments

To guage hydrocephalus in zebrafish larvae, Rhodamine- or FITC-conjugated fluorescent dye (70 kDa) have been injected immediately into the mind ventricles at 2 or 3 dpf. Briefly, ccdc57 mutants and management siblings have been first anesthetized utilizing 0.01% tricaine after which incubated with 20 mM 2,3-butanedione monoxime (BDM, Sigma) for six minutes to cease the guts beating. The larvae have been then positioned on the floor of a 1% agarose plate and additional injected with fluorescent dye. Fluorescence photos have been collected utilizing Leica M165FC fluorescent microscope. The scale of every mind ventricle was measured and quantified utilizing ImageJ software program.

For effective particle motion evaluation, we injected 20 nm or 100 nm fluorescent beads (F8888, Thermo Fisher Scientific) into the central canal of 30 hpf (20 nm) or 3 dpf (100 nm) zebrafish larvae. The injection strategies have been much like beforehand reported [39,40]. Briefly, 30 hpf or 3 dpf larvae have been anesthetized utilizing 0.4 mg/ml tricaine after which mounted in 1.5% low melting level agarose within the lateral place. The 20-nm or 100-nm fluorescent beads have been injected into the middle of the diencephalic ventricle. At 1 hour after injection, time-lapse photos have been acquired at room temperature on an inverted Leica DMI8 spinning disk confocal microscope outfitted with an Andor iXon Life 888 EMCCD utilizing a 40X water immersion goal (N.A. = 1.1). These photos of the fluorescent beads within the rostral a part of central canal have been acquired at a body charge of 10 Hz utilizing Fusion software program. The info have been additional analyzed with ImageJ software program.

To look at the migration of fluorescent beads in central canal, we microinjected 100 nm fluorescent beads into the central canal on the place above the tip of the yolk extension. The migrated distance of fluorescent beads was captured by THUNDER Imager Mannequin Organism and quantified utilizing ImageJ software program.

Cell polarity evaluation

ImageJ software program was used to quantify cell polarity. For basal physique angle evaluation, angles have been measured between a line made between the facilities of the cell and basal our bodies and the horizontal axis, as illustrated in Fig 3E. The displacement distance ratio was calculated by dividing the gap between the middle of the cell and the middle of the basal physique by the gap from the cell heart to the cell membrane. Cell orientation and facilities have been calculated by MorphoLibJ plugins, and the uncooked knowledge have been analyzed by Microsoft Excel software program to generate graphs.

Supporting data

S9 Film. Consultant film of fluorescent beads motion (20 nm) noticed in central canal of a 30 hpf WT embryo acquired with a spinning disk microscope at 10 Hz.

The video is replayed at 10 frames per second (fps). Anterior (A) is to the left; ventral (V) is backside.

https://doi.org/10.1371/journal.pbio.3002008.s021

(AVI)

S10 Film. Consultant film of fluorescent beads motion (20 nm) noticed in central canal of a 30 hpf ccdc57 mutant embryo acquired with a spinning disk microscope at 10 Hz.

The video is replayed at 10 frames per second (fps). Anterior (A) is to the left; ventral (V) is backside.

https://doi.org/10.1371/journal.pbio.3002008.s022

(AVI)

S11 Film. Consultant film of fluorescent beads motion (100 nm) noticed in central canal of a 3 dpf WT embryo acquired with a spinning disk microscope at 10 Hz.

The video is replayed at 15 frames per second (fps). Anterior (A) is to the left; ventral (V) is backside.

https://doi.org/10.1371/journal.pbio.3002008.s023

(AVI)

S12 Film. Consultant film of fluorescent beads motion (100 nm) noticed in central canal of a 3 dpf ccdc57 mutant embryo acquired with a spinning disk microscope at 10 Hz.

The video is replayed at 15 frames per second (fps). Anterior (A) is to the left; ventral (V) is backside.

https://doi.org/10.1371/journal.pbio.3002008.s024

(AVI)

S1 Knowledge. Excel spreadsheet containing, in separate sheets, the underlying numerical knowledge and statistical evaluation for Figs 2E, 3E, 3F, 3G, 4C, 4F, 5B, 5D, 5E, 5G, 5J, 6I, 6K, 7C, 7E, 7H, 8B, 8E, 9B, 9C, 9D, S1B, S1C, S1D, S1E, S2F, S3C, S3D, S5D, S5E, S6D, S7C, S8B, S9M and S12D.

https://doi.org/10.1371/journal.pbio.3002008.s027

(XLSX)

References

  1. 1.
    Weinstein SL. The Pure Historical past of Adolescent Idiopathic Scoliosis. J Pediatr Orthop. 2019;39(Concern 6, Complement 1 Suppl 1):S44-S6. Epub 2019/06/07. pmid:31169647.
  2. 2.
    Boswell CW, Ciruna B. Understanding Idiopathic Scoliosis: A New Zebrafish Faculty of Thought. Traits Genet. 2017;33(3):183–196. pmid:28174019.
  3. 3.
    Chook NC, Mabee PM. Developmental morphology of the axial skeleton of the zebrafish, Danio rerio (Ostariophysi: Cyprinidae). Dev Dyn. 2003;228(3):337–57. Epub 2003/10/28. pmid:14579374.
  4. 4.
    Xie H, Li M, Kang Y, Zhang J, Zhao C. Zebrafish: an vital mannequin for understanding scoliosis. Cell Mol Life Sci. 2022;79(9):506. Epub 2022/09/05. pmid:36059018; PubMed Central PMCID: PMC9441191.
  5. 5.
    Zhao L, Gao F, Gao S, Liang Y, Lengthy H, Lv Z, et al. Biodiversity-based improvement and evolution: the rising analysis programs in mannequin and non-model organisms. Sci China Life Sci. 2021;64(8):1236–1280. pmid:33893979.
  6. 6.
    Grimes DT, Boswell CW, Morante NF, Henkelman RM, Burdine RD, Ciruna B. Zebrafish fashions of idiopathic scoliosis hyperlink cerebrospinal fluid move defects to backbone curvature. Science. 2016;352(6291):1341–4. Epub 2016/06/11. pmid:27284198; PubMed Central PMCID: PMC5574193.
  7. 7.
    Track Z, Zhang X, Jia S, Yelick PC, Zhao C. Zebrafish as a Mannequin for Human Ciliopathies. J Genet Genomics 2016;43(3):107–120. pmid:27020031.
  8. 8.
    Zhang X, Jia S, Chen Z, Chong YL, Xie H, Feng D, et al. Cilia-driven cerebrospinal fluid move directs expression of urotensin neuropeptides to straighten the vertebrate physique axis. Nat Genet. 2018;50(12):1666–73. Epub 2018/11/14. pmid:30420648.
  9. 9.
    Wang X, Wang S, Meng Z, Zhao C. Adrb1 and Adrb2b are the foremost beta-adrenergic receptors regulating physique axis straightening in zebrafish. J Genet Genomics. 2020;47(12):781–4. Epub 2021/02/10. pmid:33558126.
  10. 10.
    Lu H, Shagirova A, Goggi JL, Yeo HL, Roy S. Reissner fibre-induced urotensin signalling from cerebrospinal fluid-contacting neurons prevents scoliosis of the vertebrate backbone. Biol Open. 2020;9(5). pmid:32409296; PubMed Central PMCID: PMC7240301.
  11. 11.
    Cantaut-Belarif Y, Orts Del’Immagine A, Penru M, Pezeron G, Wyart C, Bardet PL. Adrenergic activation modulates the sign from the Reissner fiber to cerebrospinal fluid-contacting neurons throughout improvement. Elife. 2020:9. pmid:33048048; PubMed Central PMCID: PMC7591253.
  12. 12.
    Jalalvand E, Robertson B, Wallen P, Grillner S. Ciliated neurons lining the central canal sense each fluid motion and pH by ASIC3. Nat Commun. 2016;7:10002. pmid:26743691; PubMed Central PMCID: PMC4729841
  13. 13.
    Jalalvand E, Robertson B, Tostivint H, Wallen P, Grillner S. The Spinal Twine Has an Intrinsic System for the Management of pH. Curr Biol. 2016;26(10):1346–1351. pmid:27133867.
  14. 14.
    Fidelin Ok, Djenoune L, Stokes C, Prendergast A, Gomez J, Baradel A, et al. State-Dependent Modulation of Locomotion by GABAergic Spinal Sensory Neurons. Curr Biol. 2015;25(23):3035–47. Epub 2016/01/12. pmid:26752076.
  15. 15.
    Bohm UL, Prendergast A, Djenoune L, Nunes Figueiredo S, Gomez J, Stokes C, et al. CSF-contacting neurons regulate locomotion by relaying mechanical stimuli to spinal circuits. Nat Commun. 2016;7:10866. pmid:26946992; PubMed Central PMCID: PMC4786674.
  16. 16.
    Hubbard JM, Bohm UL, Prendergast A, Tseng PB, Newman M, Stokes C, et al. Intraspinal Sensory Neurons Present Highly effective Inhibition to Motor Circuits Guaranteeing Postural Management throughout Locomotion. Curr Biol. 2016;26(21):2841–53. Epub 2016/10/11. pmid:27720623.
  17. 17.
    Wu MY, Carbo-Tano M, Mirat O, Lejeune FX, Roussel J, Quan FB, et al. Spinal sensory neurons challenge onto the hindbrain to stabilize posture and improve locomotor velocity. Curr Biol. 2021;31(15):3315–29 e5. Epub 2021/06/20. pmid:34146485.
  18. 18.
    Desban L, Prendergast A, Roussel J, Rosello M, Geny D, Wyart C, et al. Regulation of the apical extension morphogenesis tunes the mechanosensory response of microvilliated neurons. PLoS Biol. 2019;17(4):e3000235. Epub 2019/04/20. pmid:31002663; PubMed Central PMCID: PMC6493769.
  19. 19.
    Troutwine BR, Gontarz P, Konjikusic MJ, Minowa R, Monstad-Rios A, Sepich DS, et al. The Reissner Fiber Is Extremely Dynamic In Vivo and Controls Morphogenesis of the Backbone. Curr Biol. 2020;30(12):2353–62 e3. pmid:32386529; PubMed Central PMCID: PMC7891109.
  20. 20.
    Cantaut-Belarif Y, Sternberg JR, Thouvenin O, Wyart C, Bardet PL. The Reissner Fiber within the Cerebrospinal Fluid Controls Morphogenesis of the Physique Axis. Curr Biol. 2018;28(15):2479–86 e4. Epub 2018/07/31. pmid:30057305; PubMed Central PMCID: PMC6089837.
  21. 21.
    Orts-Del’Immagine A, Cantaut-Belarif Y, Thouvenin O, Roussel J, Baskaran A, Langui D, et al. Sensory Neurons Contacting the Cerebrospinal Fluid Require the Reissner Fiber to Detect Spinal Curvature In Vivo. Curr Biol. 2020;30(5):827–39 e4. Epub 2020/02/23. pmid:32084399.
  22. 22.
    Rose CD, Pompili D, Henke Ok, Van Gennip JLM, Meyer-Miner A, Rana R, et al. SCO-Spondin Defects and Neuroinflammation Are Conserved Mechanisms Driving Spinal Deformity throughout Genetic Fashions of Idiopathic Scoliosis. Curr Biol. 2020;30(12):2363–73 e6. Epub 2020/05/11. pmid:32386528.
  23. 23.
    Caprile T, Hein S, Rodriguez S, Montecinos H, Rodriguez E. Reissner fiber binds and transports away monoamines current within the cerebrospinal fluid. Mind Res Mol Mind Res. 2003;110(2):177–192. pmid:12591155.
  24. 24.
    Alejevski F, Leemans M, Gaillard AL, Leistenschneider D, de Flori C, Bougerol M, et al. Conserved position of the urotensin II receptor 4 signalling pathway to manage physique straightness in a tetrapod. Open Biol. 2021;11(8):210065. Epub 2021/08/11. pmid:34375549; PubMed Central PMCID: PMC8354755.
  25. 25.
    Dai Z, Wang Y, Wu Z, Feng Z, Liu Z, Qiu Y, et al. Novel Mutations in UTS2R are Related to Adolescent Idiopathic Scoliosis within the Chinese language Inhabitants. Backbone (Phila Pa 1976). 2021;46(5):E288–E93. pmid:33156271.
  26. 26.
    Lun MP, Monuki ES, Lehtinen MK. Growth and features of the choroid plexus-cerebrospinal fluid system. Nat Rev Neurosci. 2015;16(8):445–57. Epub 2015/07/16. pmid:26174708; PubMed Central PMCID: PMC4629451.
  27. 27.
    Sawamoto Ok, Wichterle H, Gonzalez-Perez O, Cholfin JA, Yamada M, Spassky N, et al. New neurons observe the move of cerebrospinal fluid within the grownup mind. Science. 2006;311(5761):629–32. Epub 2006/01/18. pmid:16410488.
  28. 28.
    Boutin C, Labedan P, Dimidschstein J, Richard F, Cremer H, Andre P, et al. A twin position for planar cell polarity genes in ciliated cells. Proc Natl Acad Sci U S A. 2014;111(30):E3129–38. Epub 2014/07/16. pmid:25024228; PubMed Central PMCID: PMC4121795.
  29. 29.
    Ohata S, Nakatani J, Herranz-Perez V, Cheng J, Belinson H, Inubushi T, et al. Lack of Dishevelleds disrupts planar polarity in ependymal motile cilia and leads to hydrocephalus. Neuron. 2014;83(3):558–71. Epub 2014/07/22. pmid:25043421; PubMed Central PMCID: PMC4126882.
  30. 30.
    Guirao B, Meunier A, Mortaud S, Aguilar A, Corsi JM, Strehl L, et al. Coupling between hydrodynamic forces and planar cell polarity orients mammalian motile cilia. Nat Cell Biol. 2010;12(4):341–50. Epub 2010/03/23. pmid:20305650.
  31. 31.
    Mirzadeh Z, Han YG, Soriano-Navarro M, Garcia-Verdugo JM, Alvarez-Buylla A. Cilia set up ependymal planar polarity. J Neurosci. 2010;30(7):2600–2610. pmid:20164345; PubMed Central PMCID: PMC2873868.
  32. 32.
    Fuertes-Alvarez S, Maeso-Alonso L, Villoch-Fernandez J, Wildung M, Martin-Lopez M, Marshall C, et al. p73 regulates ependymal planar cell polarity by modulating actin and microtubule cytoskeleton. Cell Dying Dis. 2018;9(12):1183. Epub 2018/12/07. pmid:30518789; PubMed Central PMCID: PMC6281643.
  33. 33.
    Tissir F, Qu Y, Montcouquiol M, Zhou L, Komatsu Ok, Shi D, et al. Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, resulting in deadly hydrocephalus. Nat Neurosci. 2010;13(6):700–7. Epub 2010/05/18. pmid:20473291.
  34. 34.
    Varagur Ok, Sanka SA, Strahle JM. Syndromic Hydrocephalus. Neurosurg Clin N Am. 2022;33(1):67–79. Epub 2021/11/22. pmid:34801143.
  35. 35.
    Schlosser TPC, Semple T, Carr SB, Padley S, Loebinger MR, Hogg C, et al. Scoliosis convexity and organ anatomy are associated. Eur Backbone J. 2017;26(6):1595–1599. pmid:28180983.
  36. 36.
    Henson HE, Parupalli C, Ju B, Taylor MR. Practical and genetic evaluation of choroid plexus improvement in zebrafish. Entrance Neurosci. 2014;8:364. Epub 2014/11/27. pmid:25426018; PubMed Central PMCID: PMC4226144.
  37. 37.
    Jiao S, Dai W, Lu L, Liu Y, Zhou J, Li Y, et al. The conserved clusterin gene is expressed within the growing choroid plexus below the regulation of notch however not IGF signaling in zebrafish. Endocrinology. 2011;152(5):1860–71. Epub 2011/03/10. pmid:21385939.
  38. 38.
    D’Gama PP, Qiu T, Cosacak MI, Rayamajhi D, Konac A, Hansen JN, et al. Variety and performance of motile ciliated cell sorts inside ependymal lineages of the zebrafish mind. Cell Rep. 2021;37(1):109775. pmid:34610312; PubMed Central PMCID: PMC8524669.
  39. 39.
    Thouvenin O, Keiser L, Cantaut-Belarif Y, Carbo-Tano M, Verweij F, Jurisch-Yaksi N, et al. Origin and position of the cerebrospinal fluid bidirectional move within the central canal. Elife. 2020:9. pmid:31916933; PubMed Central PMCID: PMC6989091.
  40. 40.
    Thouvenin O, Cantaut-Belarif Y, Keiser L, Gallaire F, Wyart C. Automated Evaluation of Cerebrospinal Fluid Circulate and Motile Cilia Properties in The Central Canal of Zebrafish Embryos. Bio Protoc. 2021;11(5):e3932. Epub 2021/04/03. pmid:33796606; PubMed Central PMCID: PMC8005886.
  41. 41.
    Borovina A, Superina S, Voskas D, Ciruna B. Vangl2 directs the posterior tilting and uneven localization of motile main cilia. Nat Cell Biol. 2010;12(4):407–12. Epub 2010/03/23. pmid:20305649.
  42. 42.
    Gurkaslar HK, Culfa E, Arslanhan MD, Lince-Faria M, Firat-Karalar EN. CCDC57 Cooperates with Microtubules and Microcephaly Protein CEP63 and Regulates Centriole Duplication and Mitotic Development. Cell Rep. 2020;31(6):107630. Epub 2020/05/14. pmid:32402286.
  43. 43.
    Kupfer A, Louvard D, Singer SJ. Polarization of the Golgi equipment and the microtubule-organizing heart in cultured fibroblasts on the fringe of an experimental wound. Proc Natl Acad Sci U S A. 1982;79(8):2603–7. Epub 1982/04/01. pmid:7045867; PubMed Central PMCID: PMC346248.
  44. 44.
    Wallingford JB. Planar cell polarity signaling, cilia and polarized ciliary beating. Curr Opin Cell Biol. 2010;22(5):597–604. Epub 2010/09/08. pmid:20817501; PubMed Central PMCID: PMC2974441.
  45. 45.
    Meunier A, Azimzadeh J. Multiciliated Cells in Animals. Chilly Spring Harb Perspect Biol. 2016;8(12). Epub 2016/09/02. pmid:27580630; PubMed Central PMCID: PMC5131768.
  46. 46.
    Shimada Y, Yonemura S, Ohkura H, Strutt D, Uemura T. Polarized transport of Frizzled alongside the planar microtubule arrays in Drosophila wing epithelium. Dev Cell. 2006;10(2):209–22. Epub 2006/02/07. pmid:16459300.
  47. 47.
    Vladar EK, Bayly RD, Sangoram AM, Scott MP, Axelrod JD. Microtubules allow the planar cell polarity of airway cilia. Curr Biol. 2012;22(23):2203–12. Epub 2012/11/06. pmid:23122850; PubMed Central PMCID: PMC3518597.
  48. 48.
    Butler MT, Wallingford JB. Planar cell polarity in improvement and illness. Nat Rev Mol Cell Biol. 2017;18(6):375–88. Epub 2017/03/16. pmid:28293032; PubMed Central PMCID: PMC5826606.
  49. 49.
    Clare DK, Magescas J, Piolot T, Dumoux M, Vesque C, Pichard E, et al. Basal foot MTOC organizes pillar MTs required for coordination of beating cilia. Nat Commun. 2014;5:4888. Epub 2014/09/13. pmid:25215410; PubMed Central PMCID: PMC4993237.
  50. 50.
    Kunimoto Ok, Yamazaki Y, Nishida T, Shinohara Ok, Ishikawa H, Hasegawa T, et al. Coordinated ciliary beating requires Odf2-mediated polarization of basal our bodies through basal toes. Cell. 2012;148(1–2):189–200. Epub 2012/01/24. pmid:22265411.
  51. 51.
    Zhou F, Narasimhan V, Shboul M, Chong YL, Reversade B, Roy S. Gmnc Is a Grasp Regulator of the Multiciliated Cell Differentiation Program. Curr Biol. 2015;25(24):3267–3273. pmid:26778655.
  52. 52.
    Olstad EW, Ringers C, Hansen JN, Wens A, Brandt C, Wachten D, et al. Ciliary Beating Compartmentalizes Cerebrospinal Fluid Circulate within the Mind and Regulates Ventricular Growth. Curr Biol. 2019;29(2):229–41 e6. pmid:30612902; PubMed Central PMCID: PMC6345627.
  53. 53.
    Terhune EA, Cuevas MT, Monley AM, Wethey CI, Chen X, Cattell MV, et al. Mutations in KIF7 implicated in idiopathic scoliosis in people and axial curvatures in zebrafish. Hum Mutat. 2021;42(4):392–407. pmid:33382518; PubMed Central PMCID: PMC8049985.
  54. 54.
    Buchan JG, Grey RS, Gansner JM, Alvarado DM, Burgert L, Gitlin JD, et al. Kinesin member of the family 6 (kif6) is important for backbone improvement in zebrafish. Dev Dyn. 2014;243(12):1646–1657. pmid:25283277; PubMed Central PMCID: PMC6207368.
  55. 55.
    Zhu P, Xu J, Wang Y, Zhao C. Lack of Ift74 Results in Gradual Photoreceptor Degeneration and Ciliogenesis Defects in Zebrafish. Int J Mol Sci. 2021;22(17). Epub 2021/09/11. pmid:34502236; PubMed Central PMCID: PMC8431285.
  56. 56.
    Tsujikawa M, Malicki J. Intraflagellar transport genes are important for differentiation and survival of vertebrate sensory neurons. Neuron. 2004;42(5):703–716. pmid:15182712.
  57. 57.
    Xie H, Wang X, Jin M, Li L, Zhu J, Kang Y, et al. Cilia regulate meiotic recombination in zebrafish. J Mol Cell Biol. 2022. Epub 2022/08/19. pmid:35981808.
  58. 58.
    Xie H, Kang Y, Wang S, Zheng P, Chen Z, Roy S, et al. E2f5 is a flexible transcriptional activator required for spermatogenesis and multiciliated cell differentiation in zebrafish. PLoS Genet. 2020;16(3):e1008655. pmid:32196499; PubMed Central PMCID: PMC7112233.
  59. 59.
    Leventea E, Hazime Ok, Zhao C, Malicki J. Evaluation of cilia construction and performance in zebrafish. Strategies Cell Biol. 2016;133:179–227. pmid:27263414.
  60. 60.
    Luo M, Lin Z, Zhu T, Jin M, Meng D, He R, et al. Disrupted intraflagellar transport as a result of IFT74 variants causes Joubert syndrome. Genet Med. 2021;23(6):1041–1049. pmid:33531668.

Related Articles

LEAVE A REPLY

Please enter your comment!
Please enter your name here

Latest Articles